Help - CLASHub 1.0

Frequently Asked Questions (FAQs)

CLASHub hosts data from four species: Human, Mouse, Drosophila melanogaster, and Caenorhabditis elegans. Below is the summary of available datasets:

Human

Sample Name	wild type (#)	Non-targeting sgRNA Control (#)	ZSWIM8 Knockout (#)	BioProject Number	SRR Number
A549	—	6	6	PRJNA1166120	SRR34738798, SRR34738799, SRR34738800, SRR34738801, SRR34738802, SRR34738803, SRR34738804, SRR34738805, SRR34738790, SRR34738791, SRR34738792, SRR34738793
D425	3	—	—	PRJNA1166120	SRR34757946, SRR34757949, SRR34757950
ES2	—	3	3	PRJNA1166120	SRR34757940, SRR34757941, SRR34757942, SRR34757943, SRR34757944, SRR34757945
HCT116	5	—	3	GSE164634, PRJNA1166120	SRR13415087, SRR13415088, SRR13415089, SRR13415090, SRR13415091, SRR34757939, SRR34757947, SRR34757948
HEK293T	8	—	—	GSE198250, PRJNA1166120	SRR18281055, SRR18281057, SRR18281067, SRR18281068, SRR34761041, SRR34761042, SRR34761043, SRR34761044
HepG2	3	—	—	PRJNA1166120	SRR34783077, SRR34783079, SRR34783080
Huh-7.5	12	—	—	GSE73057	SRR2413175, SRR2413176, SRR2413177, SRR2413178, SRR2413179, SRR2413180, SRR2413181, SRR2413182, SRR2413183, SRR2413184, SRR2413185, SRR2413186
H1299	—	3	3	PRJNA1166120	SRR34768260, SRR34768261, SRR34768262, SRR34768263, SRR34768274, SRR34768275
Liver tissue	1	—	—	PRJNA1166120	SRR34783163
MB002	—	4	4	PRJNA1166120	SRR34783070, SRR34783071, SRR34783072, SRR34783073, SRR34783074, SRR34783075, SRR34783076, SRR34783078
MDA-MB-231	—	6	6	PRJNA1166120	SRR30817646, SRR30817647, SRR30817648, SRR30817649, SRR30817650, SRR30817651, SRR34738794, SRR34738795, SRR34738796, SRR34738797, SRR34738806, SRR34738807
OVCAR8	—	3	3	PRJNA1166120	SRR34768264, SRR34768265, SRR34768266, SRR34768267, SRR34768276, SRR34768277
TIVE-EX-LTC	3	—	—	GSE101978	SRR5876947, SRR5876948, SRR5876949
T98G	—	3	3	PRJNA1166120	SRR34743309, SRR34743310, SRR34743311, SRR34743312, SRR34743317, SRR34743318
U87MG	—	3	3	PRJNA1166120	SRR34743313, SRR34743314, SRR34743315, SRR34743316, SRR34743319, SRR34743320
501Mel	—	3	3	PRJNA1166120	SRR34768268, SRR34768269, SRR34768270, SRR34768271, SRR34768272, SRR34768273

Mouse

Sample Name	wild type (#)	Non-targeting sgRNA Control (#)	Zswim8 Knockout (#)	BioProject Number	SRR Number
HE2.1B	6	—	—	GSE124687	SRR8395242, SRR8395243, SRR8395244, SRR8395245, SRR8395246, SRR8395247
MEF	—	2	2	PRJNA1166120	SRR34793109, SRR34793110, SRR34793111, SRR34793112
Striatal cell	—	4	4	PRJNA1093144	SRR28497185, SRR28497186, SRR28497189, SRR28497190, SRR2849718, 6SRR28497197, SRR28497198, SRR28497199, SRR28497200
3T12	3	—	—	GSE124687	SRR8395248, SRR8395249, SRR8395250
Cortex tissue	16	—	—	GSE73058	SRR2413277, SRR2413278, SRR2413279, SRR2413282, SRR2413284, SRR2413286, SRR2413288, SRR2413289, SRR2413290, SRR2413293, SRR2413297, SRR2413298, SRR2413299, SRR2413300, SRR2413301, SRR2413302
Heart tissue	2	—	—	PRJNA1166120	SRR34793107, SRR34793108
Kidney tissue	2	—	—	PRJNA1166120	SRR34793105, SRR34793106

Drosophila melanogaster

Sample Name	wild type (#)	Non-targeting sgRNA Control (#)	Dora Knockout (#)	BioProject Number	SRR Number
S2 cells	—	3	3	PRJNA896239	SRR22129325, SRR22129327, SRR22129328, SRR22129284, SRR22129287, SRR22129298

Caenorhabditis elegans

Sample Name	wild type (#)	Non-targeting sgRNA Control (#)	Ebax Knockout (#)	BioProject Number	SRR Number
Embryo	—	4	4	GSE303817	—
L3 stage	—	7	—	GSE56180	SRR1207389, SRR1207390, SRR1207391, SRR1207392, SRR1207393, SRR1207394, SRR1207395
mid-L4 stage	—	5	—	PRJNA328816	SRR3882724, SRR3882728, SRR3882949, SRR3882950, SRR3882951

Gene Expression Profile from four species: Human, Mouse, Drosophila melanogaster, and Caenorhabditis elegans. Below is the summary of available datasets:

Human

Sample Name	wild type (#)	Non-targeting sgRNA Control (#)	ZSWIM8 Knockout (#)	BioProject Number	SRR Number
A549	7	—	—	GSE263036, GSE212057, GSE199309	SRR28535493, SRR28535494, SRR28535495, SRR21237863, SRR21237869, SRR21237879, SRR18462418
D425	5	—	—	GSE151810, GSE185024, GSE123760	SRR11924485, SRR11924486, SRR16119415, SRR16119416, SRR8315029
ES2	6	—	—	GSE218794, GSE245778	SRR22410790, SRR22410791, SRR22410792, SRR26439462, SRR26439463, SRR26439464
HEK293T	7	—	—	GSE231583, GSE196043	SRR24421974, SRR24421975, SRR24421976, SRR18074813, SRR18074814, SRR18074815, SRR18074816
Hela	7	—	—	GSE273634, GSE218727, GSE199309	SRR30058518, SRR30058519, SRR30058520, SRR22407570, SRR22407571, SRR22407572, SRR18462415
HepG2	5	—	—	GSE224980, GSE264010	SRR28685775, SRR28685776, SRR28685777, SRR23387178, SRR23387179
H1299	4	—	—	GSE212057, GSE199309	SRR21237865, SRR21237873, SRR21237881, SRR18462412
K562	6	—	—	GSE199309, GSE167869	SRR18462409, SRR13800753, SRR13800754, SRR13800737, SRR13800738, SRR13800739
MB002	4	—	—	GSE261568	SRR28341540, SRR28341541, SRR28341542,SRR28341543
MCF7	7	—	—	GSE195761, GSE178905, GSE163791	SRR17944548, SRR17944549, SRR14915857, SRR14915858, SRR13296901, SRR13296902, SRR13296903
MDA-MB-231	3	—	—	GSE178532	SRR14870088, SRR14870089, SRR14870090
OVCAR8	4	—	—	GSE246325	SRR26536798, SRR26536799, SRR26536802, SRR26536803
T98G	5	—	—	GSE112241, PRJNA580150	SRR10358029, SRR10358030, SRR10358031, SRR6881782, SRR6881783
U87MG	6	—	—	GSE147626, GSE235568	SRR11433766, SRR11433767, SRR11433768, SRR24991947, SRR24991948, SRR24991949
501Mel	7	—	—	PRJNA515302, GSE104869	SRR8473015, SRR8473019, SRR8473020, SRR6163777, SRR6163778, SRR6163779, SRR6163780

Mouse

Sample Name	wild type (#)	Non-targeting sgRNA Control (#)	Zswim8 Knockout (#)	BioProject Number	SRR Number
Adrenal Gland	4	—	—	PRJNA375882	SRR5273702, SRR5273670, SRR5273654, SRR5273686
Bone Marrow	4	—	—	PRJNA375882	SRR5273648, SRR5273680, SRR5273664, SRR5273696
Brain	8	—	—	PRJNA375882	SRR5273637, SRR5273639, SRR5273641, SRR5273673, SRR5273657, SRR5273635, SRR5273689, SRR5273705
Embryonic Stem Cell	2	—	—	PRJEB27315	ERR2640636, ERR2640637
Forestomach	4	—	—	PRJNA375882	SRR5273662, SRR5273694, SRR5273678, SRR5273646
Heart	4	—	—	PRJNA375882	SRR5273651, SRR5273683, SRR5273667, SRR5273699
iNeuron	3	—	—	PRJEB27315	ERR2640652, ERR2640653, ERR2640654
Kidney	4	—	—	PRJNA375882	SRR5273655, SRR5273671, SRR5273703, SRR5273687
Large Intestine	4	—	—	PRJNA375882	SRR5273676, SRR5273692, SRR5273660, SRR5273644
Liver	8	—	—	PRJNA375882	SRR5273636, SRR5273656, SRR5273640, SRR5273634, SRR5273638, SRR5273672, SRR5273704, SRR5273688
Lung	4	—	—	PRJNA375882	SRR5273668, SRR5273700, SRR5273684, SRR5273652
MEF	3	—	—	GSE239373	SRR25443485, SRR25443484, SRR25443483
Muscle	4	—	—	PRJNA375882	SRR5273643, SRR5273691, SRR5273659, SRR5273675
Neural Precursor	2	—	—	PRJEB27315	ERR2640640, ERR2640641
Ovary	2	—	—	PRJNA375882	SRR5273665, SRR5273649
Placenta	6	—	—	GSE252281	SRR27386997, SRR27386999, SRR27386998, SRR27387000, SRR27387002, SRR27387001
Skin	5	—	—	GSE222026	SRR22952493, SRR22952494, SRR22952490, SRR22952491, SRR22952492
Small Intestine	4	—	—	PRJNA375882	SRR5273661, SRR5273693, SRR5273677, SRR5273645
Spleen	4	—	—	PRJNA375882	SRR5273653, SRR5273685, SRR5273669, SRR5273701
Stomach	4	—	—	PRJNA375882	SRR5273647, SRR5273663, SRR5273679, SRR5273695
Striatal cell	—	4	4	PRJNA1093144	SRR34804890, SRR34804891, SRR34804892, SRR34804893, SRR34804894, SRR34804895, SRR34804896, SRR34804897
Testis	2	—	—	PRJNA375882	SRR5273681, SRR5273697
Thymus	4	—	—	PRJNA375882	SRR5273650, SRR5273682, SRR5273698, SRR5273666
Vesicular Gland	3	—	—	PRJNA375882	SRR5273658, SRR5273674, SRR5273690

Drosophila melanogaster

Sample Name	wild type (#)	Non-targeting sgRNA Control (#)	Dora Knockout (#)	BioProject Number	SRR Number
S2 cells	5	4	3	GSE196837, PRJNA896239	SRR18048483, SRR18048484, SRR18048425, SRR18048423, SRR18048424, SRR22129330, SRR22129281, SRR22129317, SRR22129316, SRR18048427, SRR18048468, SRR18048426
0–4 h Embryos	4	—	—	GSE196837	SRR18048437, SRR18048436, SRR18048435, SRR18048446
8–12 h Embryos	6	—	4	GSE196837	SRR18048461, SRR18048433, SRR18048512, SRR18048481, SRR18048482, SRR18048434, SRR18048499, SRR18048531, SRR18048442, SRR18048532
12–16 h Embryos	6	—	4	GSE196837	SRR18048539, SRR18048525, SRR18048508, SRR18048459, SRR18048432, SRR18048465, SRR18048448, SRR18048497, SRR18048529, SRR18048516
16–20 h Embryos wild type	5	—	4	GSE196837	SRR18048421, SRR18048538, SRR18048479, SRR18048463, SRR18048527, SRR18048542, SRR18048443, SRR18048495, SRR18048501
Fly Non-targeting Control	—	3	—	PRJNA896239	SRR22129292, SRR22129294, SRR22129296

Caenorhabditis elegans

Sample Name	wild type (#)	Non-targeting sgRNA Control (#)	Ebax Knockout (#)	BioProject Number	SRR Number
Embryos	4	—	—	PRJNA922944	SRR23049957, SRR23049959, SRR23049928, SRR23049954
L1	6	2	2	GSE68588, GSE262626, GSE267368	SRR2010468, SRR2010469, SRR28479531, SRR28479532, SRR28479533, SRR28479534
L2	3	—	—	GSE266398	SRR28868053, SRR28868054, SRR28868055
L3	3	—	—	PRJNA684142	SRR13238604, SRR13238605, SRR13238606
L4	3	—	—	PRJNA922944	SRR23049963, SRR23049955, SRR23049961
Adult	4	1	1	PRJNA922944, GSE267368	SRR23049965, SRR23049966, SRR23049906, SRR23049937

microRNA Expression Profile data from four species: Human, Mouse, Drosophila melanogaster, and Caenorhabditis elegans. Below is the summary of available datasets:

Human

Sample Name	Wild Type (#)	Non-targeting sgRNA Control (#)	ZSWIM8 Knockout (#)	BioProject Number	SRR Number
A549	—	3	3	GSE163387	SRR13264637, SRR13264638, SRR13264639, SRR13264640, SRR13264641, SRR13264642
HEK293T	2	3	3	GSE123627, GSE158025	SRR8311265, SRR8311266, SRR12650650, SRR12650651, SRR12650652, SRR12650653, SRR12650654, SRR12650655
HeLa	2	3	3	GSE123627, GSE163387	SRR13377179, SRR13377180, SRR13264643, SRR13264644, SRR13264645, SRR13264646, SRR13264647, SRR13264648
K562	6	—	6	GSE158025, GSE163388	SRR12650656, SRR12650657, SRR12650658, SRR13264707, SRR13264708, SRR13264709, SRR12650659, SRR12650660, SRR12650661, SRR13264710, SRR13264711, SRR13264712
MCF7	—	2	3	GSE163388	SRR13264649, SRR13264650, SRR13264651, SRR13264652, SRR13264653

Mouse

Sample Name	wild type (#)	Non-targeting sgRNA Control (#)	Zswim8 Knockout (#)	BioProject Number	SRR Number
Brain	4	—	3	GSE235065, GSE148686	SRR24941005, SRR11547029, SRR24941026, SRR24940996, SRR24941021, SRR24941036, SRR24941000
Heart	4	—	5	GSE235065, GSE148686, GSE231448	SRR24941003, SRR24941027, SRR24940995, SRR11547034, SRR24941022, SRR24391641, SRR24391629, SRR24941035, SRR24940999
Kidney	4	—	5	GSE235065, GSE148686, GSE231448	SRR24941001, SRR24940993, SRR24941029, SRR11547035, SRR24941011, SRR24391611, SRR24391615, SRR24941033, SRR24941017
Liver	4	—	5	GSE235065, GSE148686	SRR24941004, SRR24940989, SRR24941030, SRR11547036, SRR24941010, SRR24391636, SRR24391616, SRR24941032, SRR24941016
Lung	4	—	5	GSE235065, GSE148686	SRR24940992, SRR24940998, SRR24941018, SRR24391640, SRR24941008, SRR24391628, SRR11547037, SRR24941031, SRR24941015
Intestine	3	—	5	GSE235065, GSE231448	SRR24941002, SRR24940994, SRR24941028, SRR24941023, SRR24941012, SRR24391637, SRR24391617, SRR24941034
Neuron	—	3	2	GSE163387	SRR13264632, SRR13264633, SRR13264634, SRR13264635, SRR13264636
MEF	—	6	6	GSE163387, GSE158025	SRR13264626, SRR13264627, SRR13264628, SRR12650662, SRR12650663, SRR12650664, SRR13264629, SRR13264630, SRR13264631, SRR12650665, SRR12650666, SRR12650667
Stomach	4	—	5	GSE235065, GSE148686, GSE231448	SRR24941020, SRR24941009, SRR24940990, SRR11547042, SRR24941006, SRR24391639, SRR24941025, SRR24391619, SRR24941013
Skin	3	—	5	GSE235065, GSE231448	SRR24941019, SRR24940991, SRR24940997, SRR24941024, SRR24391638, SRR24941007, SRR24391618, SRR24941014
Striatal cell	—	2	2	PRJNA1093144	SRR28497187, SRR28497188, SRR28497191, SRR28497192, SRR28497193, SRR28497194, SRR28497195, SRR28497196

Drosophila melanogaster

Sample Name	Wild Type (#)	Non-targeting sgRNA Control (#)	Dora Knockout (#)	BioProject Number	SRR Number
S2 cells	3	—	3	GSE163388	SRR13264713, SRR13264714, SRR13264715, SRR13264716, SRR13264717, SRR13264718

Caenorhabditis elegans

Sample Name	Wild Type (#)	Non-targeting sgRNA Control (#)	Ebax Knockout (#)	BioProject Number	Data Source
Early Embryo	2	—	2	GSE267367	SRR29013903, SRR29013904, SRR29013905, SRR29013906
Late Embryo	2	—	2	GSE267367	SRR29013899, SRR29013900, SRR29013901, SRR29013902
L1	2	—	2	GSE267367	SRR29013895, SRR29013896, SRR29013897, SRR29013898
L2	2	—	2	GSE267367	SRR29013891, SRR29013892, SRR29013893, SRR29013894
L3	2	—	2	GSE267367	SRR29013887, SRR29013888, SRR29013889, SRR29013890
L4	3	—	2	GSE267367	SRR29013866, SRR29013867, SRR29013868, SRR29013869, SRR29013870
Gravid adult	2	—	2	GSE267367	SRR29013879, SRR29013880, SRR29013881, SRR29013882
Glp-4	2	—	2	GSE267367	SRR29013875, SRR29013876, SRR29013877, SRR29013878

Step 1: Data Upload and Input
CLASHub accepts paired-end FASTQ files or clean single-end FASTA files. Users need to provide minimal information to initiate the analysis.
1.1 Paired-end Adapter Sequences:
5′ Adapter Sequence (default): GATCGTCGGACTGTAGAACT
3′ Adapter Sequence (default): TGGAATTCTCGGGTGCCAAG
1.2 Target species: (e.g., Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans)
1.3 Output file names
1.4 Email address for result notification

Step 2: Data Preprocessing
CLASHub automatically processes the uploaded data. For paired-end FASTQ files, the preprocessing pipeline includes:
2.1 Adapter Trimming: Adapter sequences are removed using cutadapt (v2.10) (Martin 2011).
2.2 Read Merging: Overlapping paired-end reads are merged using PEAR (v0.9.6) (Zhang et al. 2014).
2.3 Redundancy Collapse: Redundant reads, often from PCR amplification, are collapsed using fastx_collapser (v0.0.14).
2.4 UMI Trimming: Unique Molecular Identifiers (UMIs) are trimmed to produce clean FASTA files.
For single-end FASTA files, these preprocessing steps are not required.

Step 3: Hybrid Identification
The cleaned data is processed to identify miRNA-target hybrids. The analysis uses:
3.1 hyb (Travis et al., 2014): Aligns reads to the reference transcript database using bowtie2 (v2.5.3).
3.2 Reference Database: Includes Ensembl genome (Harrison et al., 2024) assemblies (e.g., GRCh38 for Homo sapiens, GRCm39 for Mus musculus, BDGP6.46 for Drosophila melanogaster, and WBcel235 for Caenorhabditis elegans) and mature miRNAs from miRBase (Release 22.1).
3.3 Binding Stability: Free energy (ΔG, kcal/mol) is calculated using UNAfold (v3.8) (Markham and Zuker, 2008).

Step 4: Conservation Score Calculation
Conservation scores are calculated using CLASHub.py, available on GitHub (https://github.com/UF-Xie-Lab/CLASHub/), and phyloP tracks from the UCSC Genome Browser. These scores assess the evolutionary conservation of miRNA binding sites (Perez et al. 2024). The following phyloP tracks are used for different species:
4.1 g38.phyloP100way for Homo sapiens (human)
4.2 mm39.phyloP35way for Mus musculus (mouse)
4.3 dm6.phyloP124way for Drosophila melanogaster (fruit fly)
4.4 ce11.phyloP135way for Caenorhabditis elegans (nematode)

Step 5: Hybrid Quantification and Site Type Analysis
All identified miRNA-target hybrids are quantified, and site types are classified based on sequence matching. The site types include: Offset 6mer, 6mer, 7mer-A1, 7mer-m8, and 8mer. These results are summarized into a comprehensive table, including expression levels and detailed hybrid information.

Step 6: Output Results
The final output is presented in a detailed table and summary HTML report. The table includes the following columns:
6.1 miRNA Name (from the miRBase database)
6.2 Pairing Pattern (includes miRNA sequence, target sequence, and their base pairing relationships, analyzed via UNAfold)
6.3 Gene Name (from the Ensembl database)
6.4 Gene ID (from the Ensembl database)
6.5 Conservation Score (calculated using phyloP tracks from the UCSC Genome Browser: g38.phyloP100way for Homo sapiens, mm39.phyloP35way for Mus musculus, dm6.phyloP124way for Drosophila melanogaster, and ce11.phyloP135way for Caenorhabditis elegans)
6.6 Free Energy (ΔG, kcal/mol, calculated via UNAfold)
6.7 Gene Type (e.g., mRNA, lncRNA)
6.8 Element Region (e.g., CDS, 5'UTR, or 3'UTR)
6.9 Genomic Position
6.10 Binding Site Type (e.g., 8mer, 7mer-A1, 7mer-m8, 6mer, or non-seed match)
6.11 Number of Datasets with Hybrid Occurrence (specifies the datasets where hybrids occur, including wild-type samples, non-targeting sgRNA control samples, or ZSWIM8 knockout samples)
6.12 Normalized Hybrid Abundance (quantifies the abundance of hybrids across wild-type samples, non-targeting sgRNA control samples, or ZSWIM8 knockout samples)
Step 1: Data Upload and Input
Users upload miRNA sequencing data in one of three supported formats:
1.1 Paired-End FASTQ (.gz): Requires 5′ and 3′ adapter sequences. Default adapter sequences:
5′ Adapter Sequence (default): GATCGTCGGACTGTAGAACT
3′ Adapter Sequence (default): TGGAATTCTCGGGTGCCAAG
1.2 Single-End FASTQ (.gz): Requires only the 3′ adapter sequence. Default 3′ adapter:
3′ Adapter Sequence (default): TGGAATTCTCGGGTGCCAAG
1.3 Cleaned Single-End FASTA (.gz): Does not require adapter sequences.
Additional inputs include the output file name, target species (Homo sapiens, Mus musculus, Drosophila melanogaster, or Caenorhabditis elegans), and a valid email address for result notification.

Step 2: Data Preprocessing
CLASHub processes uploaded data to produce clean FASTA files for analysis:
2.1 Adapter Trimming: Adapter sequences are removed using cutadapt (v2.10) (Martin 2011) for both paired-end and single-end FASTQ files.
2.2 Read Merging: For paired-end FASTQ files, overlapping reads are merged using PEAR (v0.9.6) (Zhang et al. 2014). Single-end files bypass this step.
2.3 Redundancy Collapse: Redundant sequences, often from PCR amplification, are removed using fastx_collapser (v0.0.14). This step applies to both paired-end and single-end files.
2.4 UMI Trimming: Unique Molecular Identifiers (UMIs) are trimmed by removing four nucleotides from both 5′ and 3′ ends using cutadapt. This step applies to paired-end and single-end FASTQ files but is skipped for cleaned single-end FASTA files.

Step 3: miRNA Identification and Quantification
The cleaned data is analyzed for miRNA quantification using a custom Python script, CLASHub.py, available on GitHub (https://github.com/UF-Xie-Lab/CLASHub/).
3.1 miRNA Mapping: Reads are aligned to mature miRNA sequences from miRBase (Release 22.1).
3.2 Sequence Matching: The first 18 nucleotides of each read are matched to the corresponding miRNA in the database for accurate identification.
3.3 Quantification: Total miRNA expression levels and isoform-specific abundances (capturing variations at the 3′ end) are calculated.

Step 4: Output Results
The AQ-miRNA-seq analysis generates the following outputs:
4.1 Total miRNA Table: Contains miRNA names and their total expression levels.
4.2 Isoform Expression Table: Provides isoform-specific abundances, including sequence variations at the 3′ ends.
4.3 Summary HTML Report: Includes key metrics such as the total number of uploaded reads, reads remaining after preprocessing, and the proportion of reads successfully aligned to known miRNAs.
Step 1: Data Upload and Input
Users upload RNA sequencing data in paired-end FASTQ (.gz) format. Required inputs include:
1.1 Adapter Sequences: Default adapter sequences for trimming are:
5′ Adapter Sequence (default): AGATCGGAAGAGCGTCGTGTA
3′ Adapter Sequence (default): AGATCGGAAGAGCACACGTCT
1.2 Output File Name: User-defined name for the output files.
1.3 Target Species: Homo sapiens (GRCh38), Mus musculus (GRCm39), Drosophila melanogaster (BDGP6), or Caenorhabditis elegans (WBcel235).
1.4 Email Address: Results will be sent to the provided email.

Step 2: Data Preprocessing
Uploaded data undergoes preprocessing to prepare for gene expression analysis:
2.1 Adapter Trimming: Adapter sequences are removed using Cutadapt (v2.10) (Martin 2011).
2.2 Genome Mapping: Trimmed reads are aligned to the reference genome using HISAT2 (v2.2.1). The supported genome assemblies include:
2.2.1 Homo sapiens (GRCh38)
2.2.2 Mus musculus (GRCm39)
2.2.3 Drosophila melanogaster (BDGP6)
2.2.4 Caenorhabditis elegans (WBcel235)

Step 3: Gene Expression Quantification
3.1 Gene Expression Quantification: Gene expression levels are quantified using StringTie (v2.2.1) to calculate Transcripts Per Million (TPM), providing normalized expression values for all detected genes.

4. Differential Gene Expression Analysis: For identifying differentially expressed genes, raw counts are generated using the prepDE.py3 script (part of StringTie). These raw counts are analyzed with DESeq2 (v1.44) to detect statistically significant changes in gene expression between experimental groups (e.g., treatment vs. control).

Step 5: Output Results
The RNA-seq analysis generates the following outputs using a custom Python script, CLASHub.py, available on GitHub (https://github.com/UF-Xie-Lab/CLASHub/):
5.1 TPM Expression Table: Provides normalized gene expression values (TPM).
5.2 Raw Count Table: Contains unprocessed gene-level counts for downstream analysis.
5.3 DESeq2 Results Table: Includes log2 fold changes, adjusted p-values, and base mean values for differentially expressed genes.
5.4 Summary HTML Report: Summarizes the total number of uploaded reads, trimmed reads, mapped reads, and key metrics for both gene expression quantification and differential analysis.
Step 1: Data Upload and Input
Users upload a differential gene expression CSV file with at least three required columns:
1.1 GeneName: Specifies gene names used for analysis.
1.2 BaseMean: Filters out genes with low expression (default threshold: 100).
1.3 log2FoldChange: Indicates the direction and magnitude of differential regulation.
Additional inputs include the target species (Homo sapiens, Mus musculus, Drosophila melanogaster, or Caenorhabditis elegans), the miRNA name, a BaseMean threshold, an output file name, and a valid email address for result delivery.

Step 2: Target Identification
Target genes are classified into two groups for analysis:
2.1 CLASH-Derived Targets:
• Conserved Targets: Identified in at least two cell types for Homo sapiens (15 cell types) and Mus musculus (7 cell types), containing 8mer or 7mer seed matches with conservation scores (phyloP > 0). For Drosophila melanogaster, conserved targets are restricted to the S2 cell line, and for Caenorhabditis elegans, they are limited to embryonic datasets.
• All Targets: Includes all genes containing seed matches (8mer, 7mer, or 6mer), covering mRNA and ncRNA biotypes.

2.2 TargetScan-Derived Targets:
TargetScan predictions are derived from the file Summary_Counts.txt, which classifies targets into conserved and non-conserved categories:
• Conserved Targets: miRNA targets specifically annotated as conserved in the TargetScan database.
• All Targets: Includes both conserved and non-conserved sites, providing a comprehensive list of predicted miRNA interactions.
Users can access the Summary_Counts.txt file for different species from the TargetScan database:
• Homo sapiens (Human): Release 8, September 2021
• Mus musculus (Mouse): Release 8, September 2021
• Drosophila melanogaster (Fly): Release 7.2, October 2018
• Caenorhabditis elegans (Worm): Release 6.2, June 2012

Step 3: Cumulative Fraction Curve Generation
The uploaded gene expression data is used to compare fold change distributions between miRNA targets (identified via CLASH or TargetScan) and non-target genes. Genes with BaseMean values below the specified threshold are excluded to ensure robust results. The analysis generates cumulative fraction curves to visualize regulatory trends, such as miRNA upregulation leading to the repression of target genes relative to non-target genes.

Step 4: Output Results
The cumulative fraction curve analysis produces the following outputs:
4.1 Cumulative Fraction Curves: Visualize fold change distributions for miRNA targets versus non-targets.
4.2 Summary Report: Includes key statistics such as the number of input genes, filtered genes (based on BaseMean), and target gene classifications (e.g., conserved or all targets).
Results are summarized using a custom Python script, CLASHub.py, available on GitHub (https://github.com/UF-Xie-Lab/CLASHub/).