CLASHub 1.0 - Analyzer

Upload Paired-End FASTQ.gz Upload Cleaned FASTA.gz

Choose Read 1 (R1) file (.fastq.gz):

Choose Read 2 (R2) file (.fastq.gz):

5' Adapter Sequence
(default: GATCGTCGGACTGTAGAACT):

3' Adapter Sequence (default: TGGAATTCTCGGGTGCCAAG):

5' UMI Length (bp):

3' UMI Length (bp):

Select species for analysis:

Output file name (without extension):

Your Email (results will be sent here):

Upload Paired-End FASTQ.gz Upload Single-End FASTQ.gz Upload Cleaned FASTA.gz

5' UMI Length (bp):

3' UMI Length (bp):

Select species for analysis:

Your Email (results will be sent here):

Quantify Expression (Paired-End FASTQ.gz) Differential Expression (Paired-End FASTQ.gz)

Select species for analysis:

Library Type:

Analysis Options:

✓ Standard Analysis

Includes gene-level quantification (TPM/Counts) using full annotation.

+ Add Exon-Intron Split Analysis

(Gaidatzis et al., 2015). Compares exonic vs. intronic changes to distinguish transcriptional from post-transcriptional regulation.

5' UMI Length (bp):

3' UMI Length (bp):

Your Email (results will be sent here):

Upload Differential Expression CSV

No file selected

Select species for analysis:

miRNA name:

Analysis Options:

✓ Standard Analysis

Groups targets into Conserved vs. All.

+ Add Stringent Filtering (Context++ Score)

Focuses on Top 25% high-efficacy targets (mRNA 3' UTR only). Ref: Agarwal et al. (2015).

BaseMean threshold:

Output file name (without extension):

Your Email (results will be sent here):

Job Queue Status

Tasks running: --

Tasks in queue: --

Check Job ID: